if it is the there are sequences from this patient who is already in the database, you want to make sure they are closely related to those from that patient.if it is the first time you search for this patient, you want to make sure it is not closely related to those from other patients who already in the database.O: Other (non-human) retroviral sequences (from LANL) only.L: LANL HIV Nucleotide Database (May 96).Y: All Synthetic (=vector) sequences from GenBank Last Full Release.V: All Viral sequences from GenBank Last Full Release.A: GenBank Last Full Release + Updates.command line: fasterfasta 10 % UVELF &. on Huey, put all sequences in one directory, one sequence per file, nothing else (use r1pol as demo example, r1env as demo results).AGAAGAAGACATAGTAATTAGATCTGAAAATTTTACAAACAATGTTAAAACCATAATAGTACAGCTGAATGAATCTATACAAATTÄatabase searchto find out if there is any cross patient or lab strain contamination AGAAGAAGACATAGTAATTAGATCTGAAAATTTTACAAACAATGTTAAAACCATAATAGTACAGCTGAATGAATCTATACAAATT >r196807ecl, 667 bases, 79866EC6 checksum. AGAAGAAGACATAGTAATTAGATCTGAAAATTTTACAAACAATGTTAAAACCATAATAGTACAGCTGAATGAATCTATACAAATT >r100705ecj, 667 bases, 634529C5 checksum. exampleÄ®xport as fasta format format example: >r100705ec2, 667 bases, 983E3ABA checksum. when you export a sequence, export them from 5'-3', all in pearson/fasta format. if one of the two strands can be clearly called, the other was ambiguous, you should leave the ambiguous call as it is, do not use the clear strain to determine the ambiguous call, the consensus will be determined by the two calls.
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |